Loading...
Images of Isabell Wenzel Zfin
(0 from 0 )1
0
0
News
Hebelprodukte
wirtschaft.t-online.de
ZFIN , DE000DZ85ER3. DZ Bank Put "Unter uns"-Star Isabell Hertel ließ sich für ihre Rolle die Haare schneiden. Ra…ale ...
Network Profiles
ZFIN Person: Hess, Isabell
zfin.org
.de. URL: Affiliation: Address: Institute of Toxicology and Genetics Forschungszentrum Karlsruhe Postfach Karlsruhe, D
ZFIN Person: Wenzel, Isabell
zfin.org
. URL: Affiliation: Address: Technische Universitaet Dresden BIOTEChnologisches Zentrum/ CRTD (Centre for Regenerative ...
ZFIN Person: Ganz, Julia
zfin.org
ZFIN ID: ZDB-PERS Grandel, H., Kaslin, J., Ganz, J., Wenzel, I., and Brand, M. (2006) Neural stem cells and neurogenesis in the … zebrafish ...
Books & Literature
Fabiana Moura Novaes Mendez - Biblioteca Digital de Teses e ...
www.teses.usp.br
ZFIN) (http://zfin.org) para esr1, esr2b e esr2a, respectivamente. (59) Lintelmann J, Katayama A, Kurihara N, Shore L, Wenzel A. Endocrine ...
Spring State Employee Information Center
library.state.or.us
ZFIN, the zebra fish model organism database, a campus as “a quiet art student,” Isabell Stanley '44 turns heads in New ...
Related Documents
The Multinational Coordinated Arabidopsis thaliana Functional ...
www.nsf.gov
Isabell Witt served from to November, before returning to erfield at ZFIN (the zebrafish database), Michael Ashburner at Flybase (the Drosophila ...
View - ResearchGate
www.researchgate.net
Isabell Hess a,b,d,1, Thomas Dickmeis a, Jean Christophe line of the developing zebrafish embryo (ZFIN database; Sprague et al., ...
BioText Search Engine
biosearch.berkeley.edu
ZFIN for zebrafish, Bartsch, R., Steger, G., Forstner, B., Wenzel, C., Pluschnig, U., ...
ALDH2 mediates 5-nitrofuran activity in multiple species
research-repository.st-andrews.ac.uk
ZFIN Direct Data Submission. Wenzel, P., Hink ...
Scientific Publications
BioEntities in Full Text - Europe PubMed Central
ukpmc.ac.uk
Wenzel PL, Saenz-Robles MT, Nair V, Ferrey A, Hagan JP, Gomez YM, Sharma N, zfin.org online publication.
Collection - Open-i - National Institutes of Health
openi.nlm.nih.gov
Wenzel M, Schmitt M, Ramp U, et al MODB is also cross-linked with ZFIN, allowing full searches between the two ...
MicroRNAs show a wide diversity of expression profiles in the ...
www.ncbi.nlm.nih.gov
zfin.org; Tsujikawa M, ... [PubMed] [Cross Ref]; Grandel H, Kaslin J, Ganz J, Wenzel I, Brand ...
(Danio rerio) - FreiDok - Albert-Ludwigs-Universität Freiburg
www.freidok.uni-freiburg.de
Isabell Heß, Annelies Weyn, Tanna Franz, Dagmar Diekhoff and Monika Held,. Baubi, Narges and ZFin home page: http://zebrafish.org/zirc/home/guide.php ...
Publications
An environmental estrogen alters reproductive hierarchies ...
zfin.org), and Ztri1 (F: 5′-AACTCAAA (44) Schafers, C.; Teigeler, M.; Wenzel, A.; Maack, G.; Fenske, M.; Segner, H. Concentration- ...
CREB activity modulates neural cell proliferation, midbrain ...
www.researchgate.net
Wenzel, I., Brand, M., Expression Analysis. Zebrafish Information Network (ZFIN) http://zfin.
Continued growth and circuit building in the anamniote visual ...
www.researchgate.net
zfin.org), il…rates that many and http://www.zfin.org) Grandel H, Kaslin J, Ganz J, Wenzel I, Brand M
Reports & Statements
Google Groups: neurolex | Google Groups
Wenzel Term Chair in Behavioral , curators from MGI and ZFIN met with researchers studying central ...
Miscellaneous
XL Group plc: FRA:XLG quotes & news - Google Finance
www.google.com
Wenzel as Senior traders - Dec 6, Compare: more ». RSK. BXP. AEX. ZFIN. PAA. RRJ ...
A Primer for Morpholino Use in Zebrafish | Abstract
online.liebertpub.com
Isabell Hess. Annual Review of : Exploring Zebrafish Genomic, Functional and Phenotypic Data Using ZFIN ...
AWSTATS DATA FILE 6.7 (build ) # If you remove this file, all ...
www.helmholtz-muenchen.de
isabell/index.html http://zfin.org/zf_info/news/jobs.html
Moja galeria Active.photo | jak cało i zdrowo przyszedłem na świat ...
www.golebiewski.net
Isabell: :35: Kensington Parka[/url] ywxk bkjx ktct gzme xtbw ypkl Fejod exxg upzv gfbi fzao fstc tpsy Jkqns mtxd zfin pbni ehsf kmfn lhin.
Pa28 - Free TXT downloads
freedownloadb.com
zfin.org. ZDB-PUB Heinrich, G. and Lum, T. Fish neurotrophins and Trk receptors Int. J. Dev He married (1) LYDIA ISABELL TEAGUE.
Poetry Café: Poema de Luz
weblog.aventar.eu
zfin breast implants 420 cc 469 Ebony facial 8 >:)) 10… %PPP What sort of work do you do? … isabell model 822 … gallery ...
ZFIN: Publication: Bajoghli et al., Evolution of genetic ...
zfin.org
ZFIN ID: ZDB-PUB AUTHORS: Aghaallaei, Narges, Bajoghli, Baubak, Boehm, Tom, Hess, Isabell, Schorpp, Michael, Venkatesh, Byrappa ...
ZFIN: Publication: Hess et al., Zebrafish model for allogeneic ...
zfin.org
ZFIN ID: ZDB-PUB Zebrafish model for allogeneic ... REGISTERED AUTHORS: Boehm, Tom, Hess, Isabell, Schorpp, Michael. KEYWORDS: ENU ...
ZFIN: Publication: Pannicke et al., Reticular dysgenesis ...
zfin.org
ZFIN ID: ZDB-PUB REGISTERED AUTHORS: Boehm, Tom, Hess, Isabell ... Eugene, Oregon. ZFIN logo design by Kari Pape, University of Oregon.
dict.md | kanna | Publications
en.dict.md
Isabell Dahlke et al. Nucleic …s Research , The Zebrafish Information Network (ZFIN): the zebrafish model organism database: ... (GO) terms that can be ...
32 - Biblioteca Digital UGF - Teses, Dissertações, Artigos Científicos ...
pos.ugf.br
Wenzel, Thibaut J.; Koller, Antonius; with the Zebrafish Information Network (ZFIN) ("http://zfin.org/":http://zfin.org/), ...
Bacillus subtilis subtilis 168 enoyl-acyl carrier protein reductase
bsubcyc.org
ZFIN (2001) Wenzel11: Wenzel M, Patra M, Albrecht D, Chen DY, Nicolaou KC, Metzler-Nolte N, Bandow JE ...
Bacillus subtilis subtilis 168 fabHA
biocyc.org
ZFIN (2001) Wenzel11: Wenzel M, Patra M, Albrecht D, Chen DY, Nicolaou KC, Metzler-Nolte N, Bandow JE (2011). "Proteomic ...
Bacillus subtilis subtilis 168 fabI - EcoCyc
www.ecocyc.org
ZFIN (2001) Wenzel11: Wenzel M, Patra M, Albrecht D, Chen DY, Nicolaou KC, Metzler-Nolte N, Bandow JE (2011). "Proteomic ...
Bacillus subtilis subtilis 168 fabI - MetaCyc
www.metacyc.org
ZFIN (2001) Wenzel11: Wenzel M, Patra M, Albrecht D, Chen DY, Nicolaou KC, Metzler-Nolte N, Bandow JE ...
Bacillus subtilis subtilis 168 mtlA
www.metacyc.org
ZFIN (2001). "Gene Ontology ... Morabbi11: Morabbi Heravi K, Wenzel M, Altenbuchner J (2011). "Regulation of ...
Bacillus subtilis subtilis 168 panB
www.biocyc.org
ZFIN (2001) Wenzel11: Wenzel M, Patra M, Albrecht D, Chen DY, Nicolaou KC, Metzler-Nolte N, Bandow JE (2011). "Proteomic ...
Bacillus subtilis subtilis 168 phosphopantothenate biosynthesis I
bsubcyc.org
ZFIN (2001) Wenzel11: Wenzel M, Patra M, Albrecht D, Chen DY, Nicolaou KC, Metzler-Nolte N, Bandow JE (2011). "Proteomic ...
Bacillus subtilis subtilis 168 ytrE
ecocyc.org
ZFIN (2001) Wenzel12: Wenzel M, Kohl B, Munch D, Raatschen N, Albada HB, Hamoen L, Metzler-Nolte N, Sahl HG, Bandow ...
Background - PLoS ONE
www.plosone.org
ZFIN) bcl2_for gcgcgtttctatcgtgattt cDNA bcl2_rev agcatgtgtgcacgtgtttt cDNA M Tanimoto N Wenzel P Rb-mediated neuronal differentiation through ...
Related search requests for Isabell Wenzel Zfin
|
People Forename Name "Zfin" (1) |
sorted by relevance / date